Stem-loop sequence bmo-mir-3428

AccessionMI0014493 (change log)
DescriptionBombyx mori miR-3428 stem-loop
Stem-loop
   cu    uuu      acug      -    u  -        ---------a     gu 
5'   aguu   aaucuu    cucaga cgug ca uuuuuccu          uuaag  g
     ||||   ||||||    |||||| |||| || ||||||||          |||||   
3'   ucag   uuggaa    gaguuu gcgu gu gagaaggg          aguuc  a
   -u    uau      ---g      c    u  c        cucaauaaca     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582012.1: 325213-325317 [-]
intergenic
Database links

Mature sequence bmo-miR-3428

Accession MIMAT0015636
Sequence

21 - 

ucagacgugucauuuuuccuauua

 - 44

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).