Stem-loop sequence bmo-mir-3272

AccessionMI0014328 (change log)
DescriptionBombyx mori miR-3272 stem-loop
Stem-loop
   a    -    u ug        g  u -       ucaac     uc   -ua         aua 
5'  uaau ucag g  aaguuugg ug c cauauuu     uaauu  uua   auuggggau   u
    |||| |||| |  |||||||| || | |||||||     |||||  |||   |||||||||   u
3'  guua gguc u  uucgaauu ac g guguaaa     auuga  aau   uggcccuug   u
   a    u    - gu        -  u a       --ucu     ca   ucc         aga 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582033.1: 3606728-3606853 [+]
intergenic
Database links

Mature sequence bmo-miR-3272

Accession MIMAT0015457
Sequence

81 - 

uaaacaguuaucuaaaugugaguca

 - 105

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).