Stem-loop sequence bmo-mir-2807d

AccessionMI0014306 (change log)
DescriptionBombyx mori miR-2807d stem-loop
Gene family MIPF0000826; mir-2807
Stem-loop
   --          a      a                          ua        g -a      c  uu   gc 
5'   agugcgaguu uuuaac uuuucgauagcguaaaaguuaguuca  uuuguaug a  ugggac gu  gcc  u
     |||||||||| |||||| ||||||||||||||||||||||||||  |||||||| |  |||||| ||  |||   
3'   ucacgcucaa aaauug aagagcuaucgcauuuuuaaucgggu  aaacauac u  accuug cg  cgg  a
   aa          a      c                          ua        g cg      u  --   ag 
Get sequence
Deep sequencing
376 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582034.1: 4583916-4584064 [+]
intergenic
Database links

Mature sequence bmo-miR-2807d

Accession MIMAT0015433
Sequence

88 - 

cagcugcauacaaaauugggc

 - 108

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).