Stem-loop sequence bmo-mir-2808d

AccessionMI0014260 (change log)
DescriptionBombyx mori miR-2808d stem-loop
Gene family MIPF0000836; mir-2808
Literature search

1 open access papers mention bmo-mir-2808d
(1 sentences)

Stem-loop
   g      u  -  ac    g   uagcaa      ug u   c  aa   a  a       ggaaaug  ac 
5'  gaguau gc ua  acug ucc      aagcag  c ucg ag  ucu cg ccggauu       cg  c
    |||||| || ||  |||| |||      ||||||  | ||| ||  ||| || |||||||       ||   
3'  uucaua ug au  ugau agg      uucguc  g ggc uc  aga gc ggccuag       gu  c
   a      -  c  cu    a   ------      gu u   -  ga   -  -       ---aaga  ca 
Get sequence
Deep sequencing
525 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582028.1: 418407-418538 [-]
intergenic
Database links

Mature sequence bmo-miR-2808d

Accession MIMAT0015386
Sequence

85 - 

ccggcgagaagcucggugugcu

 - 106

Get sequence
Deep sequencing79 reads, 3 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).