![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3180-1 |
||||||||
Accession | MI0014214 (change log) | |||||||
Symbol | HGNC:MIR3180-1 | |||||||
Description | Homo sapiens miR-3180-1 stem-loop | |||||||
Gene family | MIPF0000894; mir-3180 | |||||||
Literature search |
![]()
7 open access papers mention hsa-mir-3180-1 | |||||||
Stem-loop |
cagu ac a a c ---------- c 5' gcg gggcgg gcuucc ga gcuccgccccacgu cg a ||| |||||| |||||| || |||||||||||||| || 3' cgu cccgcc cggagg cu cgaggcggggugcg gc u --gu -- c c u aaagggcccc g |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-3180-5p |
|
Accession | MIMAT0015057 |
Sequence |
18 - cuuccagacgcuccgccccacgucg - 42 |
Deep sequencing | 1167 reads, 46 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3180-3p |
|
Accession | MIMAT0015058 |
Sequence |
62 - uggggcggagcuuccggaggcc - 83 |
Deep sequencing | 14034 reads, 62 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|