![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3164 |
|||||
Accession | MI0014194 (change log) | ||||
Symbol | HGNC:MIR3164 | ||||
Description | Homo sapiens miR-3164 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-3164 | ||||
Stem-loop |
- u g -caca 5' cu ggaaacugugacuuuaag gaaauggcg gcaga || |||||||||||||||||| ||||||||| |||| c 3' ga ccuuugacgcugaaguuc uuuugccgu cgucc g c g acuaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3164 |
|
Accession | MIMAT0015038 |
Sequence |
10 - ugugacuuuaagggaaauggcg - 31 |
Deep sequencing | 608 reads, 67 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|