Stem-loop sequence hsa-mir-3074

Accession

MI0014181 (change log)

Symbol

HGNC:MIR3074

Description

Homo sapiens miR-3074 stem-loop

Gene family

MIPF0001103; mir-3074

Literature search

4 open access papers mention hsa-mir-3074
(7 sentences)

Stem-loop

        -a    u  u        a    -gc    gugua 
5' gcucg  cucc gu ccugcuga cuga   cagu     a
   |||||  |||| || |||||||| ||||   ||||     a
3' ugggc  gagg ca ggaugacu gacu   guca     a
        gg    c  c        c    aua    agagu 

Deep sequencing

796 reads, 4.49 reads per million, 89 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 95086014-95086094 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000053075 ; NOL8-003; intron 1

  OTTHUMT00000053082 ; NOL8-010; intron 1

  OTTHUMT00000053080 ; NOL8-008; intron 1

  OTTHUMT00000402688 ; NOL8-020; intron 1

  OTTHUMT00000402689 ; NOL8-018; intron 1

  OTTHUMT00000053078 ; NOL8-006; intron 2

  OTTHUMT00000402683 ; NOL8-016; intron 2

  OTTHUMT00000402684 ; NOL8-015; intron 2

  OTTHUMT00000402685 ; NOL8-017; intron 2

  OTTHUMT00000053076 ; NOL8-004; intron 2

  OTTHUMT00000053077 ; NOL8-005; intron 2

  OTTHUMT00000402687 ; NOL8-013; intron 2

  OTTHUMT00000053079 ; NOL8-007; intron 2

  OTTHUMT00000402693 ; NOL8-028; intron 2

  OTTHUMT00000402690 ; NOL8-019; intron 2

  OTTHUMT00000402691 ; NOL8-027; intron 2

  OTTHUMT00000402692 ; NOL8-025; intron 2

  OTTHUMT00000402694 ; NOL8-026; intron 2

  OTTHUMT00000402695 ; NOL8-024; intron 2

  OTTHUMT00000402696 ; NOL8-021; intron 2

  OTTHUMT00000402697 ; NOL8-022; intron 2

  OTTHUMT00000053074 ; NOL8-002; intron 2

  OTTHUMT00000402698 ; NOL8-023; intron 2

  OTTHUMT00000402682 ; NOL8-012; intron 3

  ENST00000360868 ; NOL8-003; intron 1

  ENST00000535387 ; NOL8-010; intron 1

  ENST00000542053 ; NOL8-008; intron 1

  ENST00000411621 ; NOL8-020; intron 1

  ENST00000535807 ; NOL8-018; intron 1

  ENST00000442668 ; NOL8-006; intron 2

  ENST00000536593 ; NOL8-016; intron 2

  ENST00000545558 ; NOL8-015; intron 2

  ENST00000544867 ; NOL8-017; intron 2

  ENST00000432670 ; NOL8-004; intron 2

  ENST00000434228 ; NOL8-005; intron 2

  ENST00000433029 ; NOL8-013; intron 2

  ENST00000421075 ; NOL8-007; intron 2

  ENST00000445919 ; NOL8-028; intron 2

  ENST00000536624 ; NOL8-019; intron 2

  ENST00000542613 ; NOL8-027; intron 2

  ENST00000542573 ; NOL8-025; intron 2

  ENST00000543260 ; NOL8-026; intron 2

  ENST00000543985 ; NOL8-024; intron 2

  ENST00000544321 ; NOL8-021; intron 2

  ENST00000538215 ; NOL8-022; intron 2

  ENST00000482475 ; NOL8-002; intron 2

  ENST00000535649 ; NOL8-023; intron 2

  ENST00000358855 ; NOL8-201; intron 2

  ENST00000545444 ; NOL8-012; intron 3

Clustered miRNAs

< 10kb from hsa-mir-3074

• hsa-mir-24-1: chr9: 95086021-95086088 [+]
• hsa-mir-3074: chr9: 95086014-95086094 [-]
• hsa-mir-27b: chr9: 95085445-95085541 [+]
• hsa-mir-23b: chr9: 95085208-95085304 [+]

Database links

• EntrezGene:MIR3074
• HGNC:MIR3074
• RNAcentral:URS000075CA56_9606
• miRBase Tracker:MI0014181

Mature sequence hsa-miR-3074-5p

• Accession: MIMAT0019208
• Sequence: 12 - guuccugcugaacugagccag - 32
• Deep sequencing: 257 reads, 73 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS0000166778_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3074-5p
  • TargetScanVert:hsa-miR-3074-5p
  • miRDB:hsa-miR-3074-5p

Mature sequence hsa-miR-3074-3p

• Accession: MIMAT0015027
• Previous IDs: hsa-miR-3074
• Sequence: 50 - gauaucagcucaguaggcaccg - 71
• Deep sequencing: 533 reads, 55 experiments
• Evidence: experimental; Illumina [1-2]
• Predicted targets:
  • TargetMiner:hsa-miR-3074-3p
  • TargetScanVert:hsa-miR-3074-3p
  • miRDB:hsa-miR-3074-3p
  • microrna.org:hsa-miR-3074-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).