![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence oar-mir-21 |
|||||
Accession | MI0014116 (change log) | ||||
Description | Ovis aries miR-21 stem-loop | ||||
Gene family | MIPF0000060; mir-21 | ||||
Literature search |
![]()
10 open access papers mention oar-mir-21 | ||||
Stem-loop |
u gu a a a u a 5' gucgg agcuuauc gacug uguug cugu g a ||||| |||||||| ||||| ||||| |||| | u 3' caguc ucggguag cugac acaac ggua c c a ug - g - - u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence oar-miR-21 |
|
Accession | MIMAT0014966 |
Sequence |
8 - uagcuuaucagacugauguugac - 30 |
Deep sequencing | 357212 reads, 13 experiments |
Evidence | experimental; cloned [1-2] |
References |
|
1 |
PMID:20140706
"Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses"
Mol Biol Rep. 38:3161-3171(2011).
|
2 |
PMID:23269700
"MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200"
Physiol Genomics. 45:151-161(2013).
|