![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3064 |
|||||
Accession | MI0014026 (change log) | ||||
Symbol | MGI:Mir3064 | ||||
Description | Mus musculus miR-3064 stem-loop | ||||
Gene family | MIPF0001238; mir-3064 | ||||
Literature search |
5 open access papers mention mmu-mir-3064 | ||||
Stem-loop |
--g cu c ug - cuc u 5' gu gg uguug gugug caaaa cg a || || ||||| ||||| ||||| || c 3' ca cc acaac cacac guuuu gu a aga uu - gu c auc u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-3064-5p |
|
Accession | MIMAT0014834 |
Sequence |
3 - ucuggcuguuguggugugcaaa - 24 |
Deep sequencing | 1257 reads, 80 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-3064-3p |
|
Accession | MIMAT0014835 |
Sequence |
44 - ugccacacugcaacaccuuaca - 65 |
Deep sequencing | 72 reads, 30 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|