Stem-loop sequence api-mir-3045b

AccessionMI0014016 (change log)
DescriptionAcyrthosiphon pisum miR-3045b stem-loop
Gene family MIPF0001120; mir-3045
Stem-loop
   --        a    g     --au     uag    uc 
5'   cagaauaa agca accag    uuaug   caaa  c
     |||||||| |||| |||||    |||||   ||||   
3'   gucuuauu ucgu ugguc    ggugc   guuu  a
   aa        c    g     cgcc     -ca    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349906.1: 210741-210815 [-]
intergenic
Database links

Mature sequence api-miR-3045b

Accession MIMAT0014796
Sequence

53 - 

gccuggugugcucuuauucugaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).