Stem-loop sequence api-mir-3049

AccessionMI0014007 (change log)
DescriptionAcyrthosiphon pisum miR-3049 stem-loop
Literature search

1 open access papers mention api-mir-3049
(2 sentences)

Stem-loop 
   --u        c  c  c         ---  -ca   u 
5'    cgggaagg ag ug ggcggacug   ug   ggu c
      |||||||| || || |||||||||   ||   |||  
3'    gccuuucc uc ac cugccugac   ac   ccg g
   uuu        -  a  -         cuu  aac   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349641.1: 802520-802591 [+]
intergenic
Database links

Mature sequence api-miR-3049

Accession MIMAT0014789
Sequence

1 -  

ucgggaaggcagcugcggcggacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).