Stem-loop sequence api-mir-3048

AccessionMI0014006 (change log)
DescriptionAcyrthosiphon pisum miR-3048 stem-loop
Stem-loop
   --               gugc     aaaacc 
5'   gagagcaugaccagu    cauau      u
     |||||||||||||||    |||||       
3'   uucucguacugguca    gugua      u
   aa               ---a     cucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349795.1: 771724-771784 [+]
intergenic
Database links

Mature sequence api-miR-3048

Accession MIMAT0014788
Sequence

40 - 

ugugaacuggucaugcucuuaa

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).