Stem-loop sequence api-mir-2765

AccessionMI0014005 (change log)
DescriptionAcyrthosiphon pisum miR-2765 stem-loop
Stem-loop 
   --u  u    -    a       c  ---  uuu 
5'    gg aacu ccaa ccauugc gg   cg   u
      || |||| |||| ||||||| ||   ||    
3'    cc uuga gguu gguaacg cc   gu   a
   acu  -    a    -       c  uau  uuu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349988.1: 223177-223238 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-2765
api-mir-2765GL349988.1: 223177-223238 [+]
api-mir-3040GL349988.1: 223337-223400 [+]
Database links

Mature sequence api-miR-2765

Accession MIMAT0014787
Sequence

1 -  

ugguaacuccaaaccauugccgg

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).