Stem-loop sequence api-mir-3046

AccessionMI0014002 (change log)
DescriptionAcyrthosiphon pisum miR-3046 stem-loop
Stem-loop
   --u        -a            -    uuuuuau 
5'    uauagaua  uacaagcauaua guuu       u
      ||||||||  |||||||||||| ||||        
3'    auaucuau  auguucguauau caaa       u
   ucu        ac            g    cuuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349624.1: 47150-47221 [-]
intergenic
Database links

Mature sequence api-miR-3046

Accession MIMAT0014785
Sequence

1 - 

uuauagauaauacaagcauau

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).