Stem-loop sequence api-mir-3045a

AccessionMI0014001 (change log)
DescriptionAcyrthosiphon pisum miR-3045a stem-loop
Gene family MIPF0001120; mir-3045
Stem-loop
   --                   ---auuaac  a     c 
5'   cagaauaagggcacacuag         gu caaaa c
     |||||||||||||||||||         || |||||  
3'   gucuuauucucgugugguc         ca guuuu a
   aa                   cgcuuauac  -     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349624.1: 1900945-1901018 [-]
intergenic
Database links

Mature sequence api-miR-3045a

Accession MIMAT0014784
Sequence

1 - 

cagaauaagggcacacuagauuaacg

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).