Stem-loop sequence api-mir-3044

AccessionMI0013997 (change log)
DescriptionAcyrthosiphon pisum miR-3044 stem-loop
Stem-loop
   -----------u       u   u   c    cua 
5'             gaauucu aug gag uuug   g
               ||||||| ||| ||| ||||   g
3'             uuuaaga uau cuc aaac   u
   auacuuaacaug       u   c   a    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350497.1: 47125-47186 [-]
intergenic
Database links

Mature sequence api-miR-3044

Accession MIMAT0014782
Sequence

1 - 

ugaauucuuaugugagcuuugc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).