Stem-loop sequence api-mir-3039

AccessionMI0013990 (change log)
DescriptionAcyrthosiphon pisum miR-3039 stem-loop
Stem-loop
   --          cc  g     ug aucau 
5'   accguguuuu  cg uuuuc  u     c
     ||||||||||  || |||||  |      
3'   uggcacaaaa  gc aaaag  g     c
   gg          cu  a     gu cuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350173.1: 213598-213657 [+]
intergenic
Database links

Mature sequence api-miR-3039

Accession MIMAT0014777
Sequence

40 - 

aaaaacgucaaaacacggugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).