Stem-loop sequence api-mir-306

AccessionMI0013989 (change log)
DescriptionAcyrthosiphon pisum miR-306 stem-loop
Stem-loop 
   --uc       a  u    u    -  aauu 
5'     agguacc ag gauu cuga gu    a
       ||||||| || |||| |||| ||     
3'     ucuaugg uc cuaa gacu ca    a
   caau       g  u    u    a  aaca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350203.1: 472830-472890 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-306
api-mir-9bGL350203.1: 471721-471784 [+]
api-mir-306GL350203.1: 472830-472890 [+]
Database links

Mature sequence api-miR-306

Accession MIMAT0014776
Sequence

1 -  

ucagguaccaagugauuucuga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).