Stem-loop sequence api-mir-3035-2

AccessionMI0013980 (change log)
DescriptionAcyrthosiphon pisum miR-3035-2 stem-loop
Gene family MIPF0001146; mir-3035
Stem-loop
   --a                a    ---c u     g 
5'    uuaagacgaugaccag uaac    g cuaaa c
      |||||||||||||||| ||||    | ||||| a
3'    aauucugcuacugguc auug    c gguuu g
   uuc                -    uacc u     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350967.1: 71189-71257 [+]
intergenic
Database links

Mature sequence api-miR-3035

Accession MIMAT0014771
Sequence

48 - 

uuacuggucaucgucuuaacuu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).