Stem-loop sequence api-mir-3034

AccessionMI0013977 (change log)
Previous IDsapi-mir-3034-1
DescriptionAcyrthosiphon pisum miR-3034 stem-loop
Stem-loop
   --    a      aaugacaa       a      g 
5'   ugca cuguac        uaguagg uuauag g
     |||| ||||||        ||||||| ||||||  
3'   acgu gacaug        aucaucc aauauc g
   cu    c      -gaauaua       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349659.1: 545704-545774 [+]
intergenic
Database links

Mature sequence api-miR-3034

Accession MIMAT0014770
Sequence

1 - 

ugcaacuguacaaugacaauaguagga

 - 27

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).