Stem-loop sequence api-mir-3033

AccessionMI0013976 (change log)
DescriptionAcyrthosiphon pisum miR-3033 stem-loop
Stem-loop
   --          u  c     a   u   aa 
5'   acaagaaugg ug ccgug acg ggu  u
     |||||||||| || ||||| ||| |||   
3'   uguuuuuacc ac ggcac ugc uua  u
   ag          u  a     c   -   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349746.1: 734952-735012 [+]
intergenic
Database links

Mature sequence api-miR-3033

Accession MIMAT0014769
Sequence

39 - 

uccacggacauccauuuuuguga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).