Stem-loop sequence api-mir-3030

AccessionMI0013973 (change log)
DescriptionAcyrthosiphon pisum miR-3030 stem-loop
Stem-loop
   --a        -        u ug   gauaa 
5'    gguaacag guuuguuu g  agu     a
      |||||||| |||||||| |  |||      
3'    ccauuguc caagcaga c  uca     u
   acc        u        c cu   aaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349928.1: 618630-618692 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-3030
api-mir-3030GL349928.1: 618630-618692 [+]
api-mir-3041GL349928.1: 621192-621257 [+]
api-mir-3029GL349928.1: 621458-621518 [+]
Database links

Mature sequence api-miR-3030

Accession MIMAT0014766
Sequence

1 - 

agguaacagguuuguuuuguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).