Stem-loop sequence api-mir-3026

AccessionMI0013969 (change log)
DescriptionAcyrthosiphon pisum miR-3026 stem-loop
Stem-loop
   --u            a     g  -  --  a 
5'    cggcguaacaug ugugu cg cu  gc u
      |||||||||||| ||||| || ||  ||  
3'    gccguauugugc acaca gc ga  cg u
   aac            -     g  u  ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350206.1: 203579-203638 [-]
intergenic
Database links

Mature sequence api-miR-3026

Accession MIMAT0014762
Sequence

1 - 

ucggcguaacaugaugugugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).