Stem-loop sequence api-mir-3025

AccessionMI0013968 (change log)
DescriptionAcyrthosiphon pisum miR-3025 stem-loop
Stem-loop
   --a  a              g    ----u   a 
5'    gu guaagagaucaguu gaua     ugg a
      || |||||||||||||| ||||     ||| g
3'    ca uauucucuaguuaa cugu     auc g
   ccg  c              a    uuuau   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349666.1: 411628-411692 [+]
intergenic
Database links

Mature sequence api-miR-3025

Accession MIMAT0014761
Sequence

1 - 

aguaguaagagaucaguuggaua

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).