Stem-loop sequence api-mir-3021-1

AccessionMI0013964 (change log)
Previous IDsapi-mir-3021
DescriptionAcyrthosiphon pisum miR-3021-1 stem-loop
Gene family MIPF0001946; mir-3021
Stem-loop
   --u  u       a      gauag   c  aac 
5'    ug cuugugu guccau     cau ga   c
      || ||||||| ||||||     ||| ||    
3'    ac gggcgcg caggua     gua cu   a
   cuu  u       a      -aaag   c  ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349630.1: 1695084-1695150 [+]
intergenic
Database links

Mature sequence api-miR-3021

Accession MIMAT0014757
Sequence

1 - 

uugucuuguguaguccaugauagcauc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).