Stem-loop sequence api-mir-3019

AccessionMI0013962 (change log)
DescriptionAcyrthosiphon pisum miR-3019 stem-loop
Stem-loop
   --                      a   uu 
5'   aauuaauuggagagucaguagc gua  a
     |||||||||||||||||||||| |||  u
3'   uuaguuaaucuuucagucaucg uau  u
   au                      a   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350522.1: 253932-253992 [+]
intergenic
Database links

Mature sequence api-miR-3019

Accession MIMAT0014755
Sequence

40 - 

uacugacuuucuaauugauuua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).