Stem-loop sequence api-mir-3015b

AccessionMI0013960 (change log)
DescriptionAcyrthosiphon pisum miR-3015b stem-loop
Gene family MIPF0001111; mir-3015
Stem-loop
   --                  a   -u   guc 
5'   gccguucuuacaauguuc guu  agu   a
     |||||||||||||||||| |||  |||    
3'   cggcaagaguguuacagg caa  uca   g
   cu                  c   uu   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349654.1: 184591-184653 [+]
intergenic
Database links

Mature sequence api-miR-3015b

Accession MIMAT0014753
Sequence

42 - 

ccggacauugugagaacggcuc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).