Stem-loop sequence api-mir-3016

AccessionMI0013958 (change log)
DescriptionAcyrthosiphon pisum miR-3016 stem-loop
Stem-loop
   --auu       cau          ----  uu 
5'      gguaaca   acgucuuuag    cc  u
        |||||||   ||||||||||    ||  u
3'      ccauugu   uguagaaauc    gg  u
   ggcau       uau          uaaa  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350117.1: 223456-223518 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-3016
api-mir-3032GL350117.1: 224322-224383 [-]
api-mir-3024GL350117.1: 223576-223639 [-]
api-mir-3016GL350117.1: 223456-223518 [-]
api-mir-3053GL350117.1: 223099-223161 [-]
Database links

Mature sequence api-miR-3016

Accession MIMAT0014751
Sequence

1 - 

auugguaacacauacgucuuuag

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).