Stem-loop sequence api-mir-998

AccessionMI0013953 (change log)
DescriptionAcyrthosiphon pisum miR-998 stem-loop
Stem-loop
   --           c a    cg  uguaau 
5'   gcugaauuuua g gugc  ca      g
     ||||||||||| | ||||  ||       
3'   cgacuuaaggu c cacg  gu      u
   gu           a -    au  ucugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349823.1: 315079-315137 [-]
intergenic
Database links

Mature sequence api-miR-998

Accession MIMAT0014747
Sequence

39 - 

uagcaccauggaauucagcug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).