Stem-loop sequence api-mir-92b-2

AccessionMI0013947 (change log)
DescriptionAcyrthosiphon pisum miR-92b-2 stem-loop
Gene family MIPF0001099; mir-92_2
Literature search

1 open access papers mention api-mir-92b-2
(1 sentences)

Stem-loop 
   --      u    uu         ---uau     auu    u 
5'   agguug guug  ugcaauaug      uguac   accg g
     |||||| ||||  |||||||||      |||||   ||||  
3'   uccgac cagu  acguuauac      acaug   uggc u
   cg      c    uc         ucuagc     -cc    g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL364522.1: 4960-5041 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-92b-2
api-mir-92a-2GL364522.1: 5137-5203 [-]
api-mir-92b-2GL364522.1: 4960-5041 [-]
Database links

Mature sequence api-miR-92b

Accession MIMAT0014743
Sequence

61 -  

uauugcacuugacccagccugc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).