Stem-loop sequence api-mir-929

AccessionMI0013943 (change log)
DescriptionAcyrthosiphon pisum miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   --aaa         g         - -   u 
5'      uugacucua uagggaguc c uua a
        ||||||||| ||||||||| | |||  
3'      gacuggggu aucccucag g aau u
   aguua         a         u u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349683.1: 424027-424086 [-]
intergenic
Database links

Mature sequence api-miR-929

Accession MIMAT0014741
Sequence

1 - 

aaauugacucuaguagggag

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).