Stem-loop sequence api-mir-927

AccessionMI0013942 (change log)
DescriptionAcyrthosiphon pisum miR-927 stem-loop
Gene family MIPF0000452; mir-927
Stem-loop 
   --    g     cu       a   uaca 
5'   uuua aauuc  acgcuuu ccg    a
     |||| |||||  ||||||| |||    u
3'   aaau uuaag  ugcgaaa ggc    u
   ca    g     uu       c   uauu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349685.1: 676583-676641 [-]
intergenic
Database links

Mature sequence api-miR-927

Accession MIMAT0014740
Sequence

1 -  

uuuagaauuccuacgcuuuacc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).