Stem-loop sequence api-mir-8

AccessionMI0013939 (change log)
DescriptionAcyrthosiphon pisum miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention api-mir-8
(11 sentences)

Stem-loop 
   --    -        g   g      -   a a 
5'   cguc uuacuugg cag auuaga gug c a
     |||| |||||||| ||| |||||| ||| |  
3'   guag aauggacu guc uaaucu uau g u
   cu    u        -   a      g   a u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349795.1: 1044256-1044318 [-]
intergenic
Database links

Mature sequence api-miR-8

Accession MIMAT0014737
Sequence

41 -  

uaauacugucagguaaugauguc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).