Stem-loop sequence api-mir-981

AccessionMI0013938 (change log)
DescriptionAcyrthosiphon pisum miR-981 stem-loop
Stem-loop
   --u       -    ug  ug     uugacauu 
5'    ggguuuc uuga  ac  ggacc        a
      ||||||| ||||  ||  |||||         
3'    uccaaag agcu  ug  cuugg        u
   agu       u    gu  --     uauaauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349816.1: 103288-103352 [+]
intergenic
Database links

Mature sequence api-miR-981

Accession MIMAT0014736
Sequence

44 - 

uucguugucgaugaaaccuuga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).