Stem-loop sequence api-mir-316

AccessionMI0013933 (change log)
DescriptionAcyrthosiphon pisum miR-316 stem-loop
Gene family MIPF0000254; mir-316
Literature search

1 open access papers mention api-mir-316
(2 sentences)

Stem-loop 
   -u         c         c    g   a 
5'   gucuuuuuc gcuuugcug cgaa ugu a
     ||||||||| ||||||||| |||| |||  
3'   cagagaaag ugaaacgac guuu gca a
   gu         -         a    a   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349950.1: 102463-102524 [+]
intergenic
Database links

Mature sequence api-miR-316

Accession MIMAT0014731
Sequence

1 -  

ugucuuuuuccgcuuugcugccg

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).