Dead miRNA entry

miRNA accession:
MI0013931
miRNA ID:
api-mir-307-2
Forward to:
MI0013930
Comment:
Two previously annotated mir-307 entries map to the same locus in the AphidBase2 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence api-mir-307-2

AccessionMI0013931 (change log)
DescriptionAcyrthosiphon pisum miR-307-2 stem-loop
Stem-loop
   --a         uuu  a    a  --u  a 
5'    cucacucaa   gg ugug ug   uc a
      |||||||||   || |||| ||   || a
3'    gagugaguu   cc acac ac   gg u
   agc         ccu  a    c  cgc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence api-miR-307

Accession MIMAT0014729
Sequence

39 - 

accacaaccuccuugagugagcg

 - 61

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).