Stem-loop sequence api-mir-279b

AccessionMI0013925 (change log)
DescriptionAcyrthosiphon pisum miR-279b stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   --        uuu       g   -  gaau 
5'   gugggugu   ucuaguc aca cu    a
     ||||||||   ||||||| ||| ||     
3'   uacucaca   agaucag ugu ga    u
   ac        ucu       -   c  aacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349674.1: 320342-320401 [-]
intergenic
Database links

Mature sequence api-miR-279b

Accession MIMAT0014725
Sequence

40 - 

ugacuagaucuacacucauca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).