Stem-loop sequence api-mir-275

AccessionMI0013921 (change log)
DescriptionAcyrthosiphon pisum miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

1 open access papers mention api-mir-275
(5 sentences)

Stem-loop
   --g      a    c  u  ua    - u   a 
5'    gcugcu cagg ac cu  gacu c uua u
      |||||| |||| || ||  |||| | |||  
3'    cgauga gucc ug ga  cuga g agu g
   gcg      a    a  -  --    a c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350222.1: 161796-161857 [+]
intergenic
Database links

Mature sequence api-miR-275

Accession MIMAT0014721
Sequence

42 - 

ucagguaccugaaguagcgcg

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).