Stem-loop sequence api-mir-252a

AccessionMI0013919 (change log)
DescriptionAcyrthosiphon pisum miR-252a stem-loop
Gene family MIPF0000285; mir-252
Literature search

1 open access papers mention api-mir-252a
(1 sentences)

Stem-loop
   --c        a u  c       ug   ucc 
5'    uaaguacu g gc gcgggag  aua   g
      |||||||| | || |||||||  |||   u
3'    auucguga c cg cguccuc  ugu   u
   acu        a u  a       ua   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349872.1: 519999-520063 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-252a
api-mir-252bGL349872.1: 513369-513431 [+]
api-mir-252aGL349872.1: 519999-520063 [+]
Database links

Mature sequence api-miR-252a

Accession MIMAT0014719
Sequence

1 - 

cuaaguacuagugccgcgggag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).