Stem-loop sequence api-mir-14

AccessionMI0013913 (change log)
DescriptionAcyrthosiphon pisum miR-14 stem-loop
Gene family MIPF0000182; mir-14
Literature search

1 open access papers mention api-mir-14
(1 sentences)

Stem-loop
   auaaa    aa   ca  c  c         uaac     uu    uuuu   u 
5'      ucgg  ggg  ug gu ggagagaga    aggcu  ggcu    aug a
        ||||  |||  || || |||||||||    |||||  ||||    ||| u
3'      agcc  ccc  au ua ccucucucu    ucuga  cuga    uau u
   ----a    -a   --  u  u         -uuu     --    ---u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349777.1: 408822-408919 [-]
intergenic
Database links

Mature sequence api-miR-14

Accession MIMAT0014714
Sequence

65 - 

ucagucuuuuucucucuccuau

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).