Stem-loop sequence api-mir-100

AccessionMI0013878 (change log)
DescriptionAcyrthosiphon pisum miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention api-mir-100
(11 sentences)

Stem-loop 
   -u   aaa       u   acga  cg    uc          uc  aaa 
5'   gug   acugagu gcu    cc  uaga  cgaacuugug  gc   g
     |||   ||||||| |||    ||  ||||  ||||||||||  ||    
3'   cac   ugacuca cga    gg  aucu  gcuugaacac  ug   u
   cu   --g       c   caua  ag    uu          ua  auu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350266.1: 135163-135261 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-100
api-mir-100GL350266.1: 135163-135261 [+]
api-let-7GL350266.1: 136852-136914 [+]
Database links

Mature sequence api-miR-100

Accession MIMAT0014687
Sequence

21 -  

gacccguagauccgaacuugug

 - 42

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S, Ronshaugen M Unpublished.
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).