![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-92-2 |
||||||||||||||
Accession | MI0013801 (change log) | |||||||||||||
Description | Taeniopygia guttata miR-92-2 stem-loop | |||||||||||||
Gene family | MIPF0000013; mir-25 | |||||||||||||
Literature search |
3 open access papers mention tgu-mir-92-2 | |||||||||||||
Stem-loop |
ccuugcacuga g uu u u gua u 5' uuucuccaugggu gggau gu gca uacuu gc g ||||||||||||| ||||| || ||| ||||| || u 3' aaggagguguccg cccug ca cgu augag ug a --------gga g uu - u --a u |
|||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence tgu-miR-92-2-5p |
|
Accession | MIMAT0031032 |
Sequence |
23 - guggggauuuguugcauuacuu - 44 |
Evidence | experimental; Illumina [2] |
Mature sequence tgu-miR-92-3p |
|
Accession | MIMAT0014574 |
Sequence |
61 - uauugcacuugucccggccugu - 82 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|