Stem-loop sequence tgu-mir-23

AccessionMI0013787 (change log)
DescriptionTaeniopygia guttata miR-23 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   -------uu   --          -  a      gugacu 
5'          ugg  guuccuggca ug ugauuu      u
            |||  |||||||||| || ||||||       
3'          acc  uagggaccgu ac acuaaa      a
   uaccgacgc   au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chrZ: 9900645-9900715 [-]
sense
ENSTGUT00000018684 ; tgu-mir-23-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-23
tgu-mir-23chrZ: 9900645-9900715 [-]
tgu-mir-27chrZ: 9900324-9900414 [-]
tgu-mir-24chrZ: 9899801-9899932 [-]
Database links

Mature sequence tgu-miR-23-5p

Accession MIMAT0014644
Previous IDstgu-miR-23*
Sequence

3 - 

uggguuccuggcaugaugauu

 - 23

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-23-3p

Accession MIMAT0014566
Previous IDstgu-miR-23
Sequence

41 - 

aucacauugccagggauuacc

 - 61

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).