Stem-loop sequence tgu-mir-218-2

AccessionMI0013730 (change log)
DescriptionTaeniopygia guttata miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

1 open access papers mention tgu-mir-218-2
(1 sentences)

Stem-loop 
   -------------------------------------------------ggguu    uuu         cu        ------g   ga 
5'                                                       uucc   gugcuugau  aaccaugu       gua  a
                                                         ||||   |||||||||  ||||||||       |||   
3'                                                       aagg   cacgaacug  uugguaca       cau  c
   gaagacggggucgucuucauagguccguacgguacgacgucccucauacgucgg    uac         uc        agguaaa   aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr13: 14950530-14950660 [-]
sense
ENSTGUT00000018763 ; tgu-mir-218-2-201; exon 1
ENSTGUT00000001584 ; SLIT3-201; intron 8
Database links

Mature sequence tgu-miR-218-5p

Accession MIMAT0014522
Sequence

11 -  

uugugcuugaucuaaccaugu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).