Stem-loop sequence tgu-let-7a-2

AccessionMI0013724 (change log)
DescriptionTaeniopygia guttata let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention tgu-let-7a-2
(4 sentences)

Stem-loop 
   ----   ---      uu   g   u             uagaa ua a 
5'     gca   uccagg  gag uag agguuguauaguu     u  c c
       |||   ||||||  ||| ||| |||||||||||||     |  | c
3'     cgu   ggguuc  uuc auc uccaacaugucaa     a  g a
   caca   ucu      cu   g   c             --uag gg a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr24: 3137431-3137522 [-]
intergenic
Clustered miRNAs
< 10kb from tgu-let-7a-2
tgu-mir-100-1chr24: 3146829-3146939 [-]
tgu-let-7a-2chr24: 3137431-3137522 [-]
Database links

Mature sequence tgu-let-7a-5p

Accession MIMAT0014519
Previous IDstgu-let-7a
Sequence

11 -  

ugagguaguagguuguauaguu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-let-7a-2-3p

Accession MIMAT0014634
Previous IDstgu-let-7a*
Sequence

56 -  

cuguacaaccuccuagcuuuc

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).