![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-101-2 |
|||||
Accession | MI0013702 (change log) | ||||
Description | Taeniopygia guttata miR-101-2 stem-loop | ||||
Gene family | MIPF0000046; mir-101 | ||||
Literature search |
1 open access papers mention tgu-mir-101-2 | ||||
Stem-loop |
-------uggc a --gu u 5' ucaguuaucacagugcug ugcu c c |||||||||||||||||| |||| | 3' agucaauagugucaugac augg g u cgacgguagga - aaau u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-101-2-5p |
|
Accession | MIMAT0014631 |
Previous IDs | tgu-miR-101* |
Sequence |
5 - ucaguuaucacagugcugaugc - 26 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence tgu-miR-101-3p |
|
Accession | MIMAT0014508 |
Previous IDs | tgu-miR-101 |
Sequence |
41 - guacaguacugugauaacugaa - 62 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|