Stem-loop sequence bmo-mir-1000

AccessionMI0013533 (change log)
DescriptionBombyx mori miR-1000 stem-loop
Gene family MIPF0000701; mir-1000
Literature search

1 open access papers mention bmo-mir-1000
(1 sentences)

Stem-loop
       -          aua      u u a        -  u 
5' ggcg cgucgcggcc   uugucc g c cagcagua cu g
   |||| ||||||||||   |||||| | | |||||||| ||  
3' ccgc gcggcgccgg   aacagg c g gucgucau ga g
       c          ccg      u u c        c  a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581752.1: 862500-862581 [+]
intergenic
Database links

Mature sequence bmo-miR-1000

Accession MIMAT0014326
Sequence

15 - 

auauuguccugucacagcagu

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; RTPCR [1], SOLID [2]

References

1
PMID:19823945 "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ Mol Biol Rep. 37:3171-3176(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).