Stem-loop sequence api-mir-993

AccessionMI0013361 (change log)
DescriptionAcyrthosiphon pisum miR-993 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop 
   ---         uc    c      uc          uaga   a 
5'    cauccguga  uacc uguaga  cgggcuuuug    aua u
      |||||||||  |||| ||||||  ||||||||||    ||| c
3'    guaggcauu  augg acaucu  gcucgaagac    uau g
   aag         cu    -      cu          -uug   a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349666.1: 1740245-1740332 [+]
intergenic
Database links

Mature sequence api-miR-993

Accession MIMAT0014135
Sequence

55 -  

gaagcucgucucuacagguaucu

 - 77

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).