Stem-loop sequence api-mir-1923

AccessionMI0013357 (change log)
DescriptionAcyrthosiphon pisum miR-1923 stem-loop
Gene family MIPF0000930; mir-1923
Stem-loop
   aacu      uuaaaau    -  uu  aua    ---uuu   a   u 
5'     ugccau       gcug gc  cg   acgu      uca uaa a
       ||||||       |||| ||  ||   ||||      ||| |||  
3'     gcggug       ugac cg  gc   ugcg      agu auu u
   ---g      ------c    a  uu  -ca    cuaauc   a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349922.1: 6284-6369 [-]
intergenic
Database links

Mature sequence api-miR-1923

Accession MIMAT0014131
Sequence

58 - 

aaucgcguaccguugcacagucguggc

 - 84

Get sequence
Evidence by similarity; MI0008393

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).