Stem-loop sequence api-mir-iab-4

AccessionMI0013355 (change log)
DescriptionAcyrthosiphon pisum miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   c     -         a  u    c   a u   uua 
5'  ccugu acguauacu aa guau cug g gca   u
    ||||| ||||||||| || |||| ||| | |||   a
3'  ggaca ugcauauga uu caua ggc c ugu   a
   -     a         c  c    u   - -   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349895.1: 475784-475856 [-]
intergenic
Database links

Mature sequence api-miR-iab-4

Accession MIMAT0014129
Sequence

7 - 

acguauacuaaauguauccuga

 - 28

Get sequence
Evidence by similarity; MI0000432

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).